This is a cached page for the URL ( To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
QIMR's EST generation from phage plaques

(Schisto Genome Network Homepage)

The Queensland Institute for Medical Research (QIMR) lab's method for automated sequencing for expressed sequence tags from Schistosoma japonicum and/or S. mansoni cDNA libraries constructed in the directional vectors lambda ZAP II and UNI ZAP XR

contributed by Paul Brindley

(1) Select "white/clear" plaques at random from lawns of phage-infected E. coli cultured on LB-agar containing 12.5 mg/ml tetracycline, 50 mg/ml 5-bromo-4-chloro-3-indoyl-D- galactopyranoside (X-Gal), and 50 mg/ml isopropyl-1-thio-D-galactopyranoside (IPTG).

(2) Elute phage from the plaques into (~100 ul) 100 mM Tris, pH 7.5, 200 mM NaCl

(3) Use ~3 µl of the supernatant as the template for polymerase chain reactions employing pBluescript-specific primers

With ~100 ng*or less of each primer per 50 µl PCR reaction.

PCR cycling conditions : 94 C, 1 min, 50 C, 1 min, 72 C, 1 min, 30 cycles.

(4) PCR products greater than ~400 bp in length are employed as templates for cycle sequencing using the T3-specific oligonucleotide 5' - ATTAACCCTCACTAAAGGGA - 3' (20 to 50 ng) as the primer in order to determine the sequence of the 5'- end of the clone. About 2.5 µl of the unpurified, PCR product is used as the template for the cycle sequencing reaction

Cycle sequencing conditions: 96 C, 30 sec, 50 C, 15 sec, 60 C, 4 min, 25 cycles. This works well for 20 µl or 10 µl cycle sequencing reactions.

Taq DyeDeoxy Terminator Cycle Sequencing System reagents (Applied Biosystems, Foster City, CA [ABI]) are used.


*The less Reverse and Forward primers used the better, as a residual amount of these primers is likely be present in the cycling sequencing reaction, and it probable that too much residual Forward and/or Reverse primers will cause problems (interference signals) when sequencing the PCR product with the T3 primer.

(Schisto Genome Network Homepage)

updated 06/08/98