This is a cached page for the URL (http://www.laboratoryexperiments.com/LAB2.htm). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
The Molecular Biology Labs - LAB 2
LISTS | LAB 1 | LAB 3 | LAB 4 | LAB 5 | LAB 6 | LAB 7 | LAB 8 | LAB 9 | APPEND 1 | APPEND 2

LaboratoryExperiments.com


The Molecular Biology Labs


LAB 2: Polymerase Chain Reaction

| MATERIALS | SUPPLIES | PROCEDURES | RESULTS |

Materials:

  1. Taq (or other) PCR enzyme (5 Units/ul)
  2. PCR enzyme reaction buffer
  3. Distilled water (nuclease free)
  4. DNA to be used as template, such as GAPDH template from Clontech
  5. DNA to be used as upstream and downstream primers, such as the corresponding primers set for GAPDH template from ClontechTeacher's note: Upstream: accacagtccatgccatcac; Downstream: tccaccaccctgttgctgta.
  6. Light mineral oil (nuclease free)
  7. dNTP mix (10 mM of each dNTP)
Supplies:
  1. PCR machine and the 600-ul tubes for use in the machine
  2. Micropipetter and tips
  3. Microcentrifuge with adaptors for 600-ul tubes
 Procedures:
  1. Set up the following 2 reactions (final volume of 50 ul each):Teacher's note: Care should be taken to avoid cross contamination. 
      	  				            Sample       Control  ================================================== =========== ===========   distilled water				             40 ul       42 ul  10 X PCR enzyme reaction buffer	                      5 ul        5 ul  dNTP mix					      1 ul        1 ul  PCR enzyme					      0.25 ul     0.25 ul
  2. Tab tubes gently to mix and spin for 2 seconds in a microcentrifuge.
  3. Add:Teacher's note: Care should be taken to avoid cross contamination. 
      						    Sample	 Control  ================================================== =========== ===========  downstream primer stock (50 uM)			      1 ul	  1 ul  upstream primer stock (50 uM)			      1 ul	  1 ul  template (at a concentration of 0.5-2 ng/10 ul)	      2 ul	  0 ul
  4. Overlay each tube with 1-2 drops (20-40 ul) of mineral oil.Teacher's note: Care should be taken to avoid cross contamination.
  5. Place the tubes in PCR machine.
  6. Set up the following profile for 30 cycles:Teacher's note: This profile works well with GAPDH template DNA, other template may require need modification based on empirical tests.
    • 45 seconds at 94 C
    • 45 seconds at 60 C
    • 2 minutes at 72 C
  7. Withdraw 5 ul from each of the reactions at 15 cycles and store at 4 degrees C.
  8. Withdraw 5 ul from each of the reactions at 20 cycles and store at 4 degrees C.
  9. Withdraw 5 ul from each of the reactions at 25 cycles and store at 4 degrees C.
  10. Store the remaining at 4 degrees C when all 30 cycles are completed.
  11. Perform agarose gel electrophoresis (LAB 7) later using the stored reaction mixture.
 Results:
  1. After agarose gel electrophoresis, a band of expected size (452 basepairs) should be seen in the "sample" but not in the "control".

| GO BACK TO TOP OF THIS PAGE |

This site is produced by Scio Corporation
Send comments or suggestions to contents@LaboratoryExperiments.com