This is a cached page for the URL (http://homepages.bw.edu/~mbumbuli/molbio/labs/pcr/index.html). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
PCR
 

PCR MUTAGENESIS


The polymerase chain reaction (PCR) is a relatively new technique that has become one of the most important techniques in molecular biology. PCR is an in vitro method for preparing large amounts of specific DNA fragments from extremely sparse and/or complex templates.

PCR is based on the enzymatic amplification of a DNA fragment that is flanked by two oligonucleotide primers that anneal (stick) to opposite strands of the target sequence. The primers are oriented with their 3' ends pointing towards each other (recall that DNA is synthesized in the 5' to 3' direction). These primers are then extended by the polymerase enzyme. Repeated cycles of heat denaturation, annealing of the primers to their complementary sequences and extension of the primers result in the amplification of the segment defined by the 5' ends of the primers. The intervening sequence is that target of amplification and millions of copies of this sequence are generated by PCR.

[For a more thorough discussion of PCR, see pages 79-84 in your text]

In our experiment, we will use primers which flank the TFIIIA gene. Thus, we will create millions of copies of the TFIIIA gene and then use this DNA to transform yeast in another lab.

The enzyme used for PCR is Taq polymerase. This is a DNA polymerase which has been obtained from a bacteria which live in thermal vents below the ocean. The reason this enzyme is used is because unlike other enzymes, it is not denatured at high temperatures. Thus, we can denature the DNA without worrying about denaturing the enzyme.

Taq polymerase lacks a 3' -> 5' exonucleolytic editing activity (that is, it lacks the proofreading function found in most DNA polymerases). It has an estimated error rate of 10-5 to 10-4 error per nucleotide synthesized. Thus, one would expect this enzyme to add the wrong base one time out of every 10,000 to 100,000 nucleotides synthesized. It is also possible to make Taq polymerase even more error prone by altering the concentrations of MgCl2 and MnCl2, along with holding the concentration of one nucleotide lower than the other three. These properties of Taq make it a good vehicle for introducing random base substitutions into a gene of a 1000 nucleotides or more.

Objective: By altering the reaction conditions in a polymerase chain reaction, random mutations will be introduced into the TFIIIA gene.

Procedure:

1. Obtain a small microfuge tube and label it.

2. To the microfuge tube, add 14 microliters of sterile, distilled water.

3. Add the 2.5 microliters of the 10X buffer (this maintains the pH at a value where the enzyme can function efficiently).

4. Add 3 microliters of 25 mM MgCl2 and 0.5 microliters of 5 mM MnCl2. The MgCl2 facilitates the annealing of the primer, and the MnCl2 will cause the polymerase to be more error prone.

5. Add 0.5 microliters of template DNA (1:100 dilution of pG1-802). pG1-802 is a plasmid which contains the TFIIIA gene.

6. Add 0.5 microliters of GP5 primer (1 mg/ml) and 0.5 microliters of VP3 primer (1 mg/ml). These are the two primers which flank the TFIIIA gene.

7. Add 0.5 microliters of 10 mM dATP and 2.5 microliters of 10 mM dCTP, dTTP, dGTP. Note the concentration of dATP in the reaction of going to be lower that the concentration of the other nucleotides. Thus, whenever the polymerase needs to incorporate dATP, it is more likely to make an error and draw from the pool of nucleotides which exist at a higher concentration.

8. Mix your solution by pipeting up and down a few times, and then briefly centrifuge. The total volume thus far should be 24.5 microliters. You can check by putting 24.5 microliters of water in a separate tube and comparing to see if the levels of volume look the same.

9. Finally, add 0.5 microliters of Taq polymerase which is in the ice bucket. Mix gently by pipeting up and down. If there are any droplets on the sides, centrifuge briefly.

10. Then add 50 microliters of mineral oil on top of the reaction. The oil covers the aqueous layer and will prevent evaporation/condensation during the cycling of temperatures.

11. The instructor will then collect the tubes and place them into the PCR machine.

PCR conditions

94o for 1 min (denaturation)
42o for 2 min (annealing)
72o for 1 min (extension)

Cycle 25 times

72o for 7 min (final extension)

Template

The template used is pG1-802 or pG1-803. These are the yeast expression plasmids which contain the gene for the TFIIIA/VP16 fusion protein. pG1-803 is the same as pG1-802 except that a Sal 1 site near the 3' end of the TFIIIA gene has been deleted.

Primers

The following primers are used:

GP5

5' TTAAATTCTACTTTTATAGTTAGTCTTTTTTTTAGTTTTAAAACACCAAGAACT TAGTTTCGACGGATCC 3'

VP3

5' CAACATGTCCAGATCGAAATCGTCTAGCGCGTCGGCATGCGCCATC GCCACGTCCTCGCCGTCTAAGTGG 3'

The GP5 primer anneals to the GPD promoter sequence 5' of the TFIIIA gene (just upstream of the Sal 1 site). The VP3 primer anneals to sequence in the VP16 gene just downstream of a Sac 1 site. Thus, the sequence which is amplified contains all of the TFIIIA gene (about 1500 nucleotides) and about 30 nucleotides of the VP16 sequence.