This is a cached page for the URL (http://tfbind.hgc.jp/). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
TFBIND INPUT

TFBIND

Please input your sequence in FASTA format, e.g.
> COMMENTS
ACATCTGCTATAAAATACGATGCAGTCACGT

TFBIND : Software for searching transcription factor binding sites (including TATA boxes, GC boxes, CCAAT boxes, transcription start sites (TSS)). This tool uses weight matrix in transcription factor database TRANSFAC R.3.4 developed by Dr. Wingender et al, and the cut-offs originally estimated by our research.

IMPORTANT NOTICE

  • ABOUT LICENSE
  • NO LICENSE REQUIRED.
    If you use our tool or cut-offs, could you please cite our paper:
    T.Tsunoda, and T.Takagi.
    Estimating Transcription Factor Bindability on DNA.
    BIOINFORMATICS, Vol.15, No.7/8, pp.622-630, 1999.

  • CUTOFF TABLE for TRANSFAC R.3.4
  • Questions &Contact To
  • About the technical issue, contact to: