| |||||||
Stewart Laboratory Standard Operating Procedure
TRAP Assay
A. Prepare lysate
Lyse cells for 20-30’ on ice in CHAPS lysis buffer.
Spin cells at 4°C for 20’
Save supernatant in a new Rnase-free tube.
Quantitate protein concentration using the Lowry protocol. Be sure to have appropriate blanks and concentration controls.
Dilute a small portion of the sample to 50 ng/
μl. Return the undiluted sample to -70°C for future use.Take one quarter of the diluted sample and boil for 5’ and crash on ice. This will serve as your heat inactivated control.
B. End label TS oligo:
Label as follows (this makes enough oligo for 10 reactions):
2 μl 10X buffer
5.2 μl TS primer
9.8 μl ddH2O
0.5 μl T4 kinaseo
o
Heat to 85°C for 5’C. Set-up TRAP reaction:
Set-up the following 50
μl reaction (this is per reaction so when performing multiply reactions prepare a supermix). Each sample should have a minimum of two conditions, the sample and the heat inactivated control. You can also set-up a dilution series if you are attempting to quantitate the activity:5
2
μl Primer2
μl labeled TS primer1
μl dNTPs (at 2.5 mM each)0.4
μl Taq37.6
μl ddH2O2
μl prepared extractD. Run reaction
Set up PCR machine as follows:
30’ at 30°C
27 cycles with the following:
94°C for 30”
60°C for 30”
E. Run gel:
12.5% acrylamide gel (0.4mm) with 0.5X TBE buffer
add 10
run gel at about 1000-1200 volts until the first dye runs off and the second dye is about 3/4 the way into the gel.
Important buffers:
1X CHAPS (3-[(Cholamidopropyl)dimethylammonio]-1-propanesulfonate) buffer (All Rnase-free)
10 mM Tris, pH 7.5
1 mM MgCl2
1 mM EGTA
0.1 mM benzamidine
5 mM 2-mercaptoethanol
0.5% CHAPS
10% glycerol
o
10X TRAP buffer
200 mM Tris, pH 8.3
15 mM MgCl2
630 mM KCl
0.5% Tween 20
10 mM EGTA
0.1% BSA50X dNTPs
2.5 mM of each dNTP
Oligos:
ACX GCGCGGCTTACCCTTACCCTTACCCTAACC
TSNT AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT
NT ATCGCTTCTCGGCCTTTT
TS AATCCGTCGAGCAGAGTT
Oligos ordered purified in solution
Concentrations for use:
Primer mix II
ACX 0.1
NT 0.01 μg/sample
TSNT 0.01 amol/sample
Primer mix III
ACX 0.1
NT 0.1 ng/sample
TSNT 0.01 amol/sample