This is a cached page for the URL (http://www.le.ac.uk/biology/phh4/methods/retros.htm). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
Isolation of Retroelement from Genomic DNA

LINKS

Heslop-Harrison Group Homepage
CREST JST Japan Centromere talk
EPSO Talk
Bio banana 
Musa genomics
British Council
Projects / people
Methods/techniques
Microarrays
Collaborations
Publications
Repetitive DNA
Courses and conferences
Chromosome Model
Supplements
Pictures/plates
CV & personal
Journal editing
Jack Heslop-Harrison 1920-1998
Publications
Pararetrovirus integration
Private Heslop-Harrison homepage
SiteMap

These pages are the sole responsibility of Pat Heslop-Harrison.

PHH4@le.ac.uk

Department of Biology, University of Leicester, LE1 7RH UK

Phone: +44/0 116 252 5079 / 3381

FAX: +44/0 116 252 2791

University of Leicester homepage

Department of Biology homepage

Isolation of Retroelement from Plant Genomic DNA

Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here.

Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposons from each group are obtained by PCR with degenerate primers (degenerate nucleotide symbols link), as listed below.  Some of the  species tested are also listed, but experience of us and many others is that the primers succeed in  most or all cases. Undegenerate primers for amplifying individual transposons are obtained from sequences in the databases. PCR protocols and programmes are given at the bottom of the page.

Revision 12/6/03: reduced amount of Taq polymerase recommended (we use enzyme from BioLine).

Ty1-copia  Degenerate Primers

These work for virtually every higher plant species (tested in over 75 species,  failed in one).  Upstream Primer: 5'ACNGCNTTYYTNCAYGG encoding   TAFLHG Downstream Primer: 5'ARCATRTCRTCNACRTA encoding YVDDML (in reverse). These two primers, from Flavell et al. (1992 a and b below), amplify a band of approximately 270bp. The primer pair 5'CARATGGARGTNAARAC encoding QMDVKT and 5'CATRTCRTCNACRTA encoding YVDDM (missing the L at the end of the Flavell primers) is used by Hirochika and Hirochika (1993 below).

Original papers are by three groups at about the same time: Flavell AJ, Smith DB, Kumar A. 1992 Extreme heterogeneity of Ty1-copia group retrotransposons in plants. Mol Gene Genet 231: 233-242 Flavell AJ, Dunbar E, Anderson R, Pearce SR, Hartley R, Kumar A. 1992. Ty1-copia group retrotransposons are ubiquitous and heterogeneous in higher plants. Nucleic Acids Res. 20: 3639-3644.

Voytas DF, Cummings MP, Konieczny A, Ausubel FM, Rodermel SR. 1992. copia-like retrotransposons are ubiquitous among plants. Proc.Natl.Acad.Sci.USA 89: 7124-7128

Hirochika H, Hirochika R. 1993. Tyl-copia group retrotransposons as ubiquitous components of plant genomes. Jpn J Genet 68: 35-46; Hirochika H, Fukuchi A, Kikuchi F. 1992. Retrotransposon families in rice. Mol.Gen.Genet. 233: 209-216.

gypsy Element Degenerate Primers

We (Heslop-Harrison and colleagues) have used the following in Hordeum (Vershinin et al., 2002), sugar beet (Kubis et al. 1998) and a variety of gymnosperms (Friesen et al. 2001, the original reference for these primers; see references page of this website for the citations).

Forward primers: GyRT1 : 5' MRNATGTGYGTNGAYTAYMG  encoding RMCVDYR  GyRT3 : 5' YKNWSNGGNTAYCAYCARAT encoding LSGYHQI

Reverse primers
GyRT4 : 5' RCAYTTNSWNARYTTNGCR encoding YAKLSKC

GyRT1/GyRT4 will give a 420bp product. GyRT3/ GyRT4 will give an approx  300bp product.

Jump to nucleotide degeneracy symbols

These were published in Friesen et al. 2001, Kubis et al. 1998

 

Alan Schulman11 Forward primer: 5' GTITAWYKTIGAYGAYRTIYTIRT Reverse primer: 5' ICKYTCISWYTGICCRTCISTYTGIGG

Andy Flavell These are still unpublished or were in Molecular Biology and Evolution 2000. They work well in 4 out of 4 species tested to date  (beans'n nematodes). Andy Flavell can send you aliquots of these if you want to use  them. 

LINE Element Degenerate Primers

Pat Heslop-Harrison These work well in Hordeum, Allium, Oryza, Secale, Nicotiana and Antirrhinum.  5' RVNRANTTYCGNCCNATHTC 3' (named BEL1) encoding [E/D/K/N/S][E/D/N] FRPIS 3' TCYGTCCCCCTRGGRRACAG 5'  (BEL2) encoding RQGDPLS (very similar to Andy's  downstream primer) Bel1/Bel2 PCR products should be approximately 410bp.

Modified with changed specificity at the 3' end by Sybille Kubis et al., 2002 Plant Molecular Biology, work well in oil palm and Brassica (Alix et al, to be submitted) and mosses, ferns and liverwords (Elsebeth Kolmos)

BEL1MF: 5'-RVNRANTTYCGNCCNATHAG-3' and

BEL2MR: 5'-GACARRGGRTCCCCCTGNCK-3'.

 

Andy Flavell These work well in Vicia.  Upstream Primer: 5' CCNGGNCCNGAYGGNWT encoding PGPDG[IMF] Downstream Primer: 5' SWNARNGGRTCNCCYTG encoding QGDPLSP or:    5'  SWNARNGGRCANCCYTG encoding QGCPLSP These primers together amplify a band of approximately 650bp. 

PCR Programmes

Typical Mix for PCR amplification: We use 50 ul for both running on a gel and cloning, 15 ul for analysis of amplification alone. We use a Biometra T-gradient PCR machine.

Component Stock concentration Amount added (ul) Final amount/ concentration    
DNA 0.5 ng/ul 3 1.5ng    
dNTPs 2.5 mM 4 200 uM each    
Primer  1 10 uM 5 50 nM.(50 pM total)    
Primer 2 10 uM 5      
MgCl2 50 mM 3.5 3.5 mM    
Buffer 10x 10X 5 1x    
Water (high quality)   32.5     Add first to tube
Taq polymerase 5U/ul 0.25 5U   Add last to tube
Total   50      

The above protocol is designed to be very reliable. For larger scale and greater specificity, reduce volume to 25 ul or 15 ul, use 0.1 U Taq polymerase per tube and 25% of above primer concentrations. A 'no DNA' control is essential; at different times, we have had major problems with false positive amplifications, so now buy water from Sigma (or other molecular biology supply companies) for use in PCR, DNA dilution, cloning experiments and other critical applications using at most 100s of microlitres. Single-primer controls are also useful to run as some species have nested retroelements in inverted orientations. It is instructive to make 'dirty' controls - with tiny amounts of dust from the lab, your pockets, your hair, powder from gloves etc. (use a tiny amount: the same 'dirt' will inhibit the real reactions, and this inhibition can also be tested in with DNA controls). In a recent course, about 30% of the 'dirty' controls gave amplification products, compared to 5% of clean controls.

Cycling conditions:

Pat 
94 C, 3 mins
[39 C / 50 secs,
72 C / 40 secs,
94 C / 1 min] X 30 cycles
72 C / 5 mins
4 C hold

Because the products are short, we usually analyse the products on 2% agarose gels, although note these are expensive and may make subsequent cloning more difficult. However, PCR product cloning kits such as the Invitrogen Topo AT cloning kit or Promega P-Gem T have overcome the difficulties of a few years ago.

Andy Flavell uses the following PCR temperatures (Techne Genius or ancient Hybaid) 95o 1 min [45oC / 1min, 72oC/ 1min, 94oC / 1 min] X 30 cycles 72oC / 7 mins 

Alan Schulman

Specific LTR Primers for SSAP, REMAP and IRAP BARE-1 5' CTAGGGCATAATTCCAACAA.  This corresponds to the first 19 bases of the  BARE-1 LTR, facing outwards from the 5' LTR, plus one selective A base to inhibit  internal priming within the BARE-1 element from the 3' LTR (see Waugh, Flavell et al 1997 for reference).  

Thv19  5' GCCCAACCGACCAGGTTGTTACAG, corresponding to bases 48- 

Some of this work was carried out under EU Framework IV projects  TEBIODIV (coordinated by Dr Andy Flavell, University of Dundee) and a Gymnosperm retroelement EU grant (David Marshall, SCRI)

Nucleotide degeneracies

R = A + G; Y = C + T;  M = A + C; S=  G + C; W = A + T; and N = A + G + C + T.