This is a cached page for the URL (http://iprotocol.mit.edu/protocol/330.htm). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
Targeted Amplification of Mutant Strand (TAMS) technology for site directed mutagenesis
protocol book |  logoff |  modify profile |  post protocol |  edit protocol |  add this to protocol book  

 
 
  Author Information
 
  Primary Author
  lei young ( lyang@rocketmail.com )
 
  Affiliation
  usyd , Australia
 
  Co-Author(s)
   
 
 
  Protocol Information
 
  Protocol ID / PID
  PUB330
 
  Category
  Molecular Biology
 
  Title
  Targeted Amplification of Mutant Strand (TAMS) technology for site directed mutagenesis  
 
  Overview
  Targeted Amplification of Mutant Strand (TAMS) technology allows multiple-site mutagenesis in a simple, half-day protocol. Its the only method that can
mutate first strand cDNA directly, and perform multiple-site mutagenesis at high efficiency in a single round. TAMS technology takes advantage of the fact that
primers with 3 mismatches usually cannot amplify the target sequence. Therefore, if two anchor mutations are incorporated into the mutant DNA strand
outside the desired mutations, they can be preferentially amplified by primers with 3 sequence matching the mutant strand but not the wild-type strand. Since
the desired mutations are in the mutant strand, the final PCR product will also contain the desired mutations.  
 
  Material
  5x mutation buffer: 250mM Tris-HCl (pH 7.6), 50mM MgCl2, 50mM DTT, 5mM ATP, and 1mM dNTP.
T4 DNA polymerase, ligase and polynucleotide kinase, RNase H
Control b-actin anchor mutagenic oligos: CGCTCGTCGTCGATCACGGCTC, AAAACCTACTGTGCGCA
Control b-actin mutagenic oligos: TGTACGTTGATATCCAG, TCCTGCGTCTAGACCTG, GCGCGGCTACAGCTCGAGCTGCCTGACG,
GCCGACAGGCTGCAGAA, AGCGCAAGTAATCCGTG, CTGGGCATGGATCCGTCCTGTGGCA
Control b-actin anchor PCR primers: GCGCTCGTCGTCGATCA, TTGTTTTCTGCGCACAG
 
 
  Procedure
  1. ssDNA template preparation

a) From RNA: Perform reverse transcription with 5mg total RNA and oligo dT primer in 20ul reaction following manufacturers protocol. Add 1ul
Ribonuclease H and incubate at 37C for 1 hour. First strand cDNA should be used as template for the b-actin control reactions.

b) From Genomic DNA: Perform 30 cycles of asymmetrical PCR with primer for the strand to be used as template at 20x concentration of the non-template
strand primer.

c) From plasmid: Perform 30 cycles of linear PCR with 100ng of template and 1 primer only.

2. Design of mutagenic oligonucleotides

Follow reference [1] for oligo design, generally a 17-19mer with single mutation in the middle will be sufficient. Make sure the mutagenic oligos are
complementary to the ssDNA template. The anchor mutagenic oligo should provide three 3 mismatched nucleotides for the anchor PCR primers to anneal to.


3. Mutagenesis protocol

a) Prepare the control and sample reactions as follows:

4ul of 5x mutation buffer
2pmol each of anchor mutagenic primers
10pmol each of desired mutagenic primers
water to final volume of 17ul

b) Add 1ul of T4 polynucleotide kinase (5U) and incubate at 37C for 1 hour.

c) Add 2ul of the single stranded DNA template. Place tubes in a beaker containing 1L of 75C water and allow slow cooling to room temperature.

d) Add 1ul of T4 DNA polymerase (5U) and 1ul of T4 DNA ligase (3U), and incubate at 37C for 1 hour.

e) Amplify 1ul of either the control reaction or sample reaction by any thermal stable polymerase with the respective anchor PCR primers. Set PCR conditions
to 1 cycle at 94C for 1 min; 25 cycles at 94C for 30 sec, 55C for 30 sec, 72C for 1 min/kb; and 1 cycle at 72C for 5 min.

f) Run 10ul of the reaction on 1% agarose gel, if bands of expected size can be seen (1kb for b-actin control reaction), then mutagenesis is successful. The
PCR product can be used in subsequent applications.




 
 
  Troubleshooting
   
 
  Reference
  [1] Piechocki, M.P (1994). BioTechniques, 16:702.  
 
 Back to the Top