This is a cached page for the URL (http://ozex.netfirms.com/TS.html). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
TemplateSelect in vitro site directed mutagenesis kit - OZEX PTY LTD

Our address has been changed to http://ozex.netfirms.com/TS.shtml, please click the link if you are not directed automatically

[Home] [Kits] [DNA Synthesis]

Introduction

The patent pending Targeted Amplification of Mutant Strand (TAMS) technology employed in OZEX's TemplateSelect SDM kit allows multiple-site mutagenesis in a simple, half-day protocol. It’s the only method that can mutate first strand cDNA directly, and perform multiple-site mutagenesis at high efficiency in a single round. TAMS technology takes advantage of the fact that primers with 3’ mismatches usually cannot amplify the target sequence. Therefore, if two anchor mutations are incorporated into the mutant DNA strand outside the desired mutations, they can be preferentially amplified by primers with 3’ sequence matching the mutant strand but not the wild-type strand. Since the desired mutations are in the mutant strand, the final PCR product will also contain the desired mutations. 

Reagents

5x mutation buffer: 250mM Tris-HCl (pH 7.6), 50mM MgCl2, 50mM DTT, 5mM ATP, and 1mM dNTP.
T4 DNA polymerase, ligase and polynucleotide kinase, ribonuclease H
Control b-actin anchor mutagenic oligos: CGCTCGTCGTCGATCACGGCTC, AAAACCTACTGTGCGCA
Control b-actin mutagenic oligos: TGTACGTTGATATCCAG, TCCTGCGTCTAGACCTG, GCGCGGCTACAGCTCGAGCTGCCTGACG, AGCGCAAGTAATCCGTG, CTGGGCATGGATCCGTCCTGTGGCA
Control b-actin anchor PCR primers: GCGCTCGTCGTCGATCA, TTGTTTTCTGCGCACAG

Procedures

1. ssDNA template preparation 

a) From RNA: Perform reverse transcription with 5ug total RNA and oligo dT primer in 20ul reaction following manufacturer’s protocol. Add 1ul Ribonuclease H and incubate at 37°C for 1 hour. 

b) From Genomic DNA: Perform 30 cycles of asymmetrical PCR with the template strand primer at 20x concentration of the non-template strand primer. The PCR product should be enriched in the template strand DNA. PCR primers for b-actin have been provided. 

c) From plasmid: Perform 30 cycles of linear PCR with 100ng of template and the template strand primer only. Make sure the template strand primer used is outside of the anchor primers. Typical PCR conditions: 94°C for 1 min, 52°C for 30 sec, and 72°C for 1 min/kb. 

2. Design of mutagenic oligonucleotides

Follow reference [1] for oligo design, generally allow at least 10bp 5’ and 8bp 3’ to the mutation. GC content of the oligos should be 40 to 50%, if this cannot be achieved, then longer primers should be used (for each 3% above 50%, add 1bp). Make sure the mutagenic oligos are complementary to the ssDNA template. The anchor mutagenic oligo should provide at least three 3’ mismatched nucleotides for the anchor PCR primers to anneal to. And the anchor PCR primers should be designed such that their 3’ end nucleotides match the mutated nucleotides.

3. Mutagenesis protocol 

a) Prepare the control and sample reactions as indicated below:
4ul of 5x mutation buffer
2pmol each of anchor mutagenic primers
10pmol each of desired mutagenic primers
water to final volume of 17ul
 
b) Add 1ul of T4 polynucleotide kinase and incubate at 37°C for 1 hour. 

c) Add 2ul of the single stranded DNA template. Place tubes in a beaker containing 1L of 75°C water and allow slow cooling to room temperature. 

d) Add 1ul of T4 DNA polymerase and 1ul of T4 DNA ligase, and incubate at 37°C for 1 hour. 

e) Amplify 1ul of either the control reaction (10pmol each of b-actin anchor PCR primers in 50ul reaction) or sample reaction by any thermal stable polymerase with the respective anchor PCR primers. Set PCR conditions to 1 cycle at 94°C for 1 min; 25 cycles at 94°C for 30 sec, 55°C for 45 sec, 72°C for 1 min/kb; and 1 cycle at 72°C for 5 min. 

f) Run 10ul of the reaction on 1% agarose gel, if bands of expected size can be seen (1kb for b-actin control reaction), then mutagenesis is successful. The PCR product can be used in subsequent applications. 

4. Evaluation of mutagenesis efficiency

The mutant b-actin PCR product should be 1061bp in length. Add MgCl2 to 10mM to the PCR product, and directly digest with restriction enzymes EcoRV, XbaI, XhoI, BamHI, and ScaI in separate tubes. The first 4 enzymes should give 2 smaller bands, and ScaI should not digest the mutant. The intensity between digested and undigested DNA in the same tube indicate the mutagenesis efficiency of the respective mutagenic oligo.

 

[1] Piechocki, M.P (1994). BioTechniques, 16:702.

[Home] [Kits] [DNA Synthesis]