Cycle Sequence Reactions For Large Insert
Plasmid Templates |  |  The following dye-labeled terminator reaction chemistries have been designed to balance conservation of reagents with the resulting sequence product signal strength. When coupled with BACPAC Resource template preparation, N-free read lengths of >400nts can be expected. More emphasis can be placed on reagent conservation by further volume reduction or dilution; or on sequence product signal strength by increasing the reaction size. Cycle Sequence Chemistry Conditions: | Chemistry3 | Reaction Size4 | Final Vol (ul) | Primer Vol (10pmol/ul) | Reaction Mix vol (ul) | Template vol (ul) | | ABI dRhod term | 1.25x | 25 | 1 | 10 | 14 | | ABI BD term | 0.75x | 15 | 1 | 6 | 8 | CycleSequenceConditions: 1) Initial denaturation step: 96oC 4min.
2) denaturation: 96oC 10sec. 3) annealing: 50oC 10sec.
4) extension: 60oC 4min. run steps 2-4 for 100 cycles. 5) hold: 4-10oC. Primers Useful For BAC and PAC Vectors: T7.29: 5’ gccgctaatacgactcactatagggagag 29mer
T7: 5’ taatacgactcactataggg 20mer gSP6: 5’ gttttttgcgatctgccgtttc 22mer
3Stock ABI Ready Reaction mixes are supplemented with 4mM MgCl2
4Refers to ABI 1x (20ul) reaction
5Annealing temp can be adjusted, based on Tm of primers used
Academic and commercial users should contact Pieter J. de Jong (pdejong@chori.org, fax: (510) 450-7924). For hybridization membranes, and individual clones, please contact BACPAC Resources (BACPACorders@chori.org).
| 
