| | | | Non-radioactive Probes I. Via random hexamers 1. Solutions: 10X hexa nt mix*: 500 mM Tris-Cl pH 7.2 100 mM MgCl2 1 mM dithioerythritol (DTE) 2 mg/ml BSA 62.5 A260 units/ml (1.56 mg/ml) random hexanucleotides 10x dig/dNTP mix*: 1 mM dATP 1 mM dCTP 1 mM dGTP 0.65 mM dTTP 0.35 mM alkali-labile digoxigenin (dig)-UTP (B-Mann cat# 1573152 or 1573179) *supplied in the dig DNA labelling kit; also can order all tubes separately, i.e. without enzyme. 2. Reaction: a. Heat at 100 deg C for 10' to denature: 15 µl (50-250ng) DNA (in TE or ddH2O) b. Cool quickly on ice (1-2') c. Add: 2 µl 10X hexa nt mix 2 µl 10X dig/dNTP mix 1 µl Klenow* (5u/µl) d. Incubate at 37 deg C>1 hr. (up to 20 hr) e. Increase volume to 50 µl; then add 5 µl 0.4 M EDTA pH 8 f. Purify through a G-50 spin column. II. Via PCR 1. Solutions: 10X PCR buffer: 100 mM Tris-Cl, pH 8.3 500 mM KCl 10X dig mix: 2 mM dATP 2 mM dCTP 2 mM dGTP 1.3 mM dTTP 0.7 mM alkali-labile dig-11-dUTP (B-Mann cat# 1573152 or 1573179) 2. Reaction: 10X PCR buffer 5 µl 25 mM MgCl2 3 µl 10X dig mix 5 µl 20 pmol oligo 1 20 pmol oligo 2 Template Taq 1 µl Water up to 50 µl 3. PCR: 94 deg C - 5 min Then 35 cycles of: 94 deg C - 30 sec 50 deg C - 1 min 70 deg C - 2 min 4. To purify, spin through a G-50 column or gel-isolate fragment (depending on the purity of the amplification). III. Riboprobe synthesis (Recommended for Northerns) 1. Solutions: 10X NTP mixture: 10 mM ATP 10 mM CTP 10 mM GTP 6.5 mM UTP 3.5 mM DIG-UTP 2. Reaction: a. Add the following reagents in order on ice: *Purified template (1 µg) + dH20 in 13 µl 10X NTP mix 2 µl 10X Transcription buffer 2 µl RNase inhibitor 1 µl RNA polymerase (SP6, T3 or T7) 2 µl *Purified template can be from a variety of sources: 1. Vectors: To avoid transcription of undesirable sequences from a linearized vector, cut vector with enzyme which leaves 5' overhangs or blunt ends, then gel purify. 2. PCR products: One can design PCR primers that include either a T3 or T7 promoter in the 5' end of the primer. Simply run the PCR and then gel purify fragment. For T3: ATCGAAATTAACCCTCACTAAAGGG For T7: ATCGATAATACGACTCACTATAGGG b. Incubate for 2 hours at 37 deg C. c. Add 2 µl DNase I and incubate 15 minutes at 37 deg C. d. Add 2 µl 0.2 M EDTA to stop reaction e. Purify on G-50 End-labeling Ladder 1. On ice mix: 32 µl sample (10 µg 1kb ladder (BRL) + H2O 5 µl 10x TMD (500 mM Tris-Cl pH 7.5, 100 mM MgCl2, 100 mM DTT) 1 µl dig-UTP (alkali-stable; B-Mann cat. #1093088 or 1558706) 2 µl T4 DNA Polymerase (1u/µl) 2. Incubate 5' at 37 deg C. 3. On ice add: 5 µl 1 mM dATP,dGTP 5 µl 1 mM dCTP 4. Incubate 15' at 30 deg C. 5. Add 6 µl stop solution (2% Sarkosyl 0.4 M EDTA pH 8.0). 6. Purify on G-50 spin column. |