This is a cached page for the URL (http://www.fhcrc.org/labs/gottschling/misc/nonrad.html). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
General Protocols
Fred Hutchinson Cancer Research Center    
HOME >  Science and Research >  Gottschling Lab
 
 
 

Non-radioactive Probes

I. Via random hexamers

1. Solutions:

10X hexa nt mix*:
500 mM Tris-Cl pH 7.2
100 mM MgCl2
1 mM dithioerythritol (DTE)
2 mg/ml BSA
62.5 A260 units/ml (1.56 mg/ml) random hexanucleotides

10x dig/dNTP mix*:
1 mM dATP
1 mM dCTP
1 mM dGTP
0.65 mM dTTP
0.35 mM alkali-labile digoxigenin (dig)-UTP (B-Mann cat# 1573152 or 1573179)

*supplied in the dig DNA labelling kit; also can order all tubes separately, i.e. without enzyme.

2. Reaction:

a. Heat at 100 deg C for 10' to denature: 15 l (50-250ng) DNA (in TE or ddH2O)

b. Cool quickly on ice (1-2')

c. Add:
2 l 10X hexa nt mix
2 l 10X dig/dNTP mix
1 l Klenow* (5u/l)

d. Incubate at 37 deg C>1 hr. (up to 20 hr)
e. Increase volume to 50 l; then add 5 l 0.4 M EDTA pH 8
f. Purify through a G-50 spin column.


II. Via PCR

1. Solutions:

10X PCR buffer:
100 mM Tris-Cl, pH 8.3
500 mM KCl

10X dig mix:
2 mM dATP
2 mM dCTP
2 mM dGTP
1.3 mM dTTP
0.7 mM alkali-labile dig-11-dUTP (B-Mann cat# 1573152 or 1573179)

2. Reaction:

10X PCR buffer 5 l
25 mM MgCl2 3 l
10X dig mix 5 l
20 pmol oligo 1
20 pmol oligo 2
Template
Taq 1 l
Water up to 50 l

3. PCR:

94 deg C - 5 min
Then 35 cycles of:
94 deg C - 30 sec
50 deg C - 1 min
70 deg C - 2 min

4. To purify, spin through a G-50 column or gel-isolate fragment (depending on the purity of the amplification).


III. Riboprobe synthesis (Recommended for Northerns)

1. Solutions:

10X NTP mixture:
10 mM ATP
10 mM CTP
10 mM GTP
6.5 mM UTP
3.5 mM DIG-UTP

2. Reaction:

a. Add the following reagents in order on ice:
*Purified template (1 g) + dH20 in 13 l
10X NTP mix 2 l
10X Transcription buffer 2 l
RNase inhibitor 1 l
RNA polymerase (SP6, T3 or T7) 2 l

*Purified template can be from a variety of sources:
1. Vectors: To avoid transcription of undesirable sequences from a linearized vector, cut vector with enzyme which leaves 5' overhangs or blunt ends, then gel purify.

2. PCR products: One can design PCR primers that include either a T3 or T7 promoter in the 5' end of the primer. Simply run the PCR and then gel purify fragment.

For T3: ATCGAAATTAACCCTCACTAAAGGG
For T7: ATCGATAATACGACTCACTATAGGG

b. Incubate for 2 hours at 37 deg C.
c. Add 2 l DNase I and incubate 15 minutes at 37 deg C.
d. Add 2 l 0.2 M EDTA to stop reaction
e. Purify on G-50


End-labeling Ladder

1. On ice mix:
32 l sample (10 g 1kb ladder (BRL) + H2O
5 l 10x TMD (500 mM Tris-Cl pH 7.5, 100 mM MgCl2, 100 mM DTT)
1 l dig-UTP (alkali-stable; B-Mann cat. #1093088 or 1558706)
2 l T4 DNA Polymerase (1u/l)

2. Incubate 5' at 37 deg C.

3. On ice add:
5 l 1 mM dATP,dGTP
5 l 1 mM dCTP

4. Incubate 15' at 30 deg C.

5. Add 6 l stop solution (2% Sarkosyl 0.4 M EDTA pH 8.0).

6. Purify on G-50 spin column.

 
Prepared By:
Michael McMurray
(206) 667-6660
Last Modified: Nov 26, 2002


  Fred Hutchinson Cancer Research Center, 1100 Fairview Ave N, Seattle, WA 98109  (206)667-5000 [ Home ][ Directory ][ News & Events ][ Donate ][ Jobs ][ Search ][ Site Map ]
  Copyright 2003 Fred Hutchinson Cancer Research Center, a non-profit organization. See Terms of Use & Privacy Policy.