This is a cached page for the URL (http://genome-www.stanford.edu/group/botlab/protocols/vectorette.html). To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content.
About Cache
Vectorette PCR of Yeast DNA

Vectorette PCR of Yeast DNA

Carl Friddle

1) Cut 1-3 g of clean DNA overnight with 8-10U of blunt cutting enzyme in 20l

Most problems come from dirty, uncut DNA. Phenol/glass bead/RNase prepared DNA works well

RsaI, AluI and DraI provide good results.

2) Heat inactivate enzyme

3) Add:

4) Incubate at 16 C for 9-24 hours.

5) Use 5l in 100l PCR. Perkin Elmer Ampliwax is recommended for hot start.

6) Gel purify 80 l of PCR product in 1-3% SeaKem GTG, extract with Qiaex (Qiagen), elute with 12 l of ddWater

7) Sequence 7 l with Sequenase kit from Amersham.

Use 1 l of 200-600M specific primer [M13(-47) for mTn3]. Undiluted 10 OD synthesis from Genset works well.

Use high specific activity S-35 (>1000 Ci/mmol, Amersham AG1000)

Boil 10' and fast cool in ice water.


Anchor Bubble primers
 3'   GAGAGGGAAGAGAGCAGGCAAGGAATGGAAGCTGTCTGTCGCAGGAGAGGAAG 5'      ||||||||||||   ||    || | | | ||| |  |   |||||||||||| 5' GACTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC  3'   PRIMER 224   5' CGAATCGTAACCGTTCGTACGAGAATCGCT 3'  

To anneal bubble primers, heat a 2-4M (in ddWater) to 65 C for 5 minutes, then add MgCl2 to 1-2 mM and allow to cool to room temperature.

Would you like to see a diagram?


References:


Back to the Botstein Lab Home Page


Web Curator: Craig Cummings, craigc@leland.stanford.edu