Cloning a cDNA sequence - (Mar/08/2007 )
Hi there, I was wondering if anyone could help me. I’m trying to clone the IkBe gene coding sequence which is, according to ncbi,
ATGAATCAACGAAGGAGTGAGTCAAGGCCCGGGAACCACAGACTCCAAGCCTACGCAGAGCCCGGGAAGGGGGATTCCGG
AGGGGCGGGGCCTCTTTCCGGAAGCGCCCGCCGGGGGCGGGGAGGGGGCGGGGCCATCCGCGTGAGGCGACCCTGTTGGTC
CGGAGGGGCGGGGCGAGGAGGAGGACCCGCTTGGGCGGTTCGGCTGCCCACAGTAACCGCTGGGTGGACCTGGCCAGCGCT
CCGAACCTTGTCCTCGCTGCGCGCCGGCCCCTCGGAGCCCCACAGCCCGGGAAGGAGGCCGCCGCGGGCCGGGCGCCCGCT
CTGCCAAGCGGACCCGCAACCCGGAAAGGCGGCGCGGCGGAGCCTGGAGCCGGATCCTGCTCAGACCGGGCCCCGGCCGGC
CAGAGCCGCGGGCATGTCGGAGGCGCGGAAGGGGCCGGACGAGGCGGAGGAGAGCCAGTACGACTCTGGCATTGAGTCTCT
GCGCTCTCTGCGCTCCCTACCCGAGTCCACCTCGGCTCCAGCCTCCGGGCCCTCGGACGGCAGCCCCCAGCCCTGCACCCA
TCCTCCGGGACCCGTCAAGGAACCACAGGAGAAGGAAGACGCGGATGGGGAGCGGGCTGATTCCACCTATGGCTCCTCCTC
GCTCACCTACACCCTGTCCTTGCTGGGGGGCCCCGAGGCTGAGGACCCGGCCCCACGCCTGCCACTCCCCCACGTGGGGGC
GCTGAGCCCTCAGCAGCTGGAAGCACTCACTTACATCTCCGAGGACGGAGACACGCTGGTCCACCTGGCAGTGATTCATGA
GGCCCCAGCGGTGCTGCTCTGTTGCCTGGCTTTGCTGCCCCAGGAGGTCCTGGACATTCAAAATAACCTTTACCAGACAGC
ACTCCATCTGGCTGTACATCTGGACCAACCGGGCGCAGTTCGGGCACTGGTGCTGAAGGGGGCCAGCCGGGCACTACAGGA
CCGGCATGGTGACACAGCCCTTCATGTGGCCTGCCAGCGCCAGCACTTGGCCTGTGCCCGCTGCCTGCTGGAAGGGCGGCC
AGAGCCAGGCAGAGGAACATCTCACTCTCTGGACCTCCAGCTGCAAAACTGGCAAGGTCTGGCTTGTCTCCACATTGCCAC
CCTTCAGAAGAACCAACCACTCATGGAATTGCTGCTTCGGAATGGAGCTGACATTGATGTGCAGGAGGGCACCAGTGGTAA
GACAGCGCTGCACCTGGCTGTGGAAACCCAAGAGCGGGGCCTGGTACAGTTCCTGCTCCAGGCTGGTGCCCAGGTAGATGC
CCGCATGCTGAACGGGTGCACACCCCTGCACCTGGCAGCTGGCCGGGGTCTCATGGGCATCTCATCCACTCTGTGCAAGGC
GGGTGCTGACTCCCTGCTGCGGAATGTGGAGGATGAGACGCCCCAGGACCTGACTGAGGAATCCCTTGTCCTTTTGCCCTT
TGATGACCTGAAGATCTCAGGGAAACTGCTGCTGTGTACCGACTGA
For cloning purposes I have designed the primers so that the forward primer has a 5’ SalI site and the two reverse primers (two primers because I’d like a product containing the stop codon and one without) with an EcoRI site (restriction sites in primers are in red). Also, there are an extra 6 random bases 5’ of the restriction site to allow enzyme digestion.
SalI tagged forward primer
5’ actggtgtcgacatgaatcaacgaaggagtgagtc 3’
EcoRI tagged reverse primer(s)
1) With stop codon
5’ gttgcagaattctcagtcggtacacagcagca 3’
2) Without stop codon
5’ ttgactgaattcggtacacagcagcagtttcc 3’
The complementary sequences of the primers extend for 20 bases of the coding sequence, giving total primer size of 30bp. I have been using Finnzyme phusion to amplify the coding sequence from cDNA extracted from Hela cells but I’m not getting a product (should be 1500bp). I’ve tried both two step PCR and three step PCR with gradients for annealing temperatures from 54-68oC.
Your reverse primer without stopcodon is not right. You missed 3 bases which are right before the stop codon from the original sequence. And I might remove the 3 bases at the end so that you will have 20 bases on both the forward and reverse primer annealing to the template.
5’ ttgactgaattcGTCggtacacagcagcagtt 3’
if you could let us know your PCR conditions, may be some one could help.
Good Luck !!!
Hi adamson,
I just GC'ed your target and it's GC = 66%. That's quite high. Chances are some DMSO or betaine in your reaction will isolate your target for you. High GC% targets are difficult to amplify because the 3 H-bonds between Gs and Cs make the target difficult to denature at points of secondary structure and along the template as a whole. DMSO and betaine both help with high GC% targets by relaxing the strength of the 3 x GC H-bonds. DMSO interferes with the H-bonds, whereas betaine equalises the strength of bonding between GC and AT. The standard concentration gradients used for DMSO is 0-9% (0, 3, 5, 7, 9%; that's 0, 1.5, 2.5, 3.5 and 4.5 uL 100% DMSO per 50 uL reaction), whereas betaine is 0 - 2M (yes, that's molar; 0, 0.5, 1.0, 1.5, 2.0M; that's 0, 5, 10, 15 and 20 uL of a 5M solution of betaine per 50 uL reaction). Try those 10 reactions, well 9 really, and I wouldn't be at all surprised if your target gets isolated.
Good luck, Rob
Also, SalI would not be an enzyme I would choose for a cloning reaction, given a choice, which you probably have. It has a bad reputation. XhoI, BamHI, PstI, many others come on the list before SalI.
Thanks for all your help! much appreciated!
The DMSO worked and gave us a product, we'll try cloning with the SalI but we can always get new primers if it doesn't work.
Thanks again.