Primer dimers - (Mar/09/2006 )
Hi guys I am a new comer . I am trying to amplify a perticular gene for which I have designed the following primers.
GTGGTGCTCGAGCTCACTCTCTGCCGGTAATA
GCTGTACCATGGCTAACGAATTAACCTG
the problem I am facing is that I am getting primer dimers and the amplified product is not that great.
I would like to know if there is some problem in the primers I have designed.
-sairam-
QUOTE (sairam @ Mar 10 2006, 03:50 AM)
Hi guys I am a new comer . I am trying to amplify a perticular gene for which I have designed the following primers.
GTGGTGCTCGAGCTCACTCTCTGCCGGTAATA
GCTGTACCATGGCTAACGAATTAACCTG
the problem I am facing is that I am getting primer dimers and the amplified product is not that great.
I would like to know if there is some problem in the primers I have designed.
GTGGTGCTCGAGCTCACTCTCTGCCGGTAATA
GCTGTACCATGGCTAACGAATTAACCTG
the problem I am facing is that I am getting primer dimers and the amplified product is not that great.
I would like to know if there is some problem in the primers I have designed.
Check your primers for palyndromic parts that can easily form dimers- if you have those and you can not take another sequence to create a new primer (which you seldom can if you want to amplify a gene), try adding different amounts of DMSO to the PCR-mix. Helped me a lot.
Hope that helps...
-Susannah-